ATG5Flox Genotyping

 

Background:

            This protocol detects the presence of a floxed ATG5 gene (floxed around the 3rd exon). 
The mouse strain in our colony was generated by Noboru Mizushima (Tokyo Medical and
Dental University).  We are in the process of backcrossing these mice back to BL6 and are
approximately 1 generation away from fully backcrossed mice (6/1/08).

 

Who designed the protocol: 

            This protocol was designed by the Mizushima lab, with the PCR conditions modified
by members of the Virgin lab
.  The Mizushima lab has also designed a protocol to detect the

rearranged flox allele which I have not included here.

 

Primer sequences:

            Check2:    ACAACGTCGAGCACAGCTGCGCAAGG

            Exon3-1:  GAATATGAAGGCACACCCCTGAAATG
         Short2:      GTACTGCATAATGGTTTAACTCTTGC

 

If you want to identify the recombinant (Atg5-deleted) band, you need to add the 5L2 primer in
the reaction.

The primer sequence is: 5L2  5'-CAGGGAATGGTGTCTCCCAC-3'.

The recombinant band is 300bp, you can run the samples in 2.5% agarose.

 

 

Reaction Mixture:

2 ul MgCl2 (25mM)

2 ul dNTPs (2mM)

2 ul 10x TAQ buffer

0.2 ul TAQ polymerase (Promega M166X  19358943)

1 ul Check 2 primer (10uM stock)              

1 ul Exon3-1 primer (10uM stock)              

1 ul Short2 primer (10uM stock)                

1 ul DNA (add 100-300ng)

10 ul dH2O

 

PCR program:

94°C             4 minutes

30 cycles:          

94°C             30 seconds

60°C             30 seconds

72°C             1 minute

 

72°C             5 minutes

4°C                ∞

 

Expected bands:

Flox allele: 650 bp

Wild Type allele: 350 bp