Evi-Flox (wntless) Mice Genotyping

 

Primers:

523 Evi P1  5 cttccctgcttctttaagcgtc 3

524 Evi P2  5 aggcttcgaacgtaactgacc 3

525 Evi P4  5 ctcagaactcccttcttgaagc  3

 

 

Genomic DNA                    1 μL

2X Master Mix                   10 μL

oligo 523                             1 μL

oligo 524                             1 μL

oligo 525                             1 μL

Water                                               6 μL

 

Total                                      20 μL

 

 

94C                          4 minutes

30 cycles:

94C                          30 seconds

62C                          30 seconds

72C                          40 seconds

 

72C                          7 minutes

4C                            

 

 

P2 & P4: WT band (411bp) and FLOX band (556 bp)

P1 & P4: KO band (410 bp) -- Possible band above 1 kb for WT/FL, but not always.